Skip to main content

Thank you for visiting nature.com. You are using a browser version with limited support for CSS. To obtain the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in Internet Explorer). In the meantime, to ensure continued support, we are displaying the site without styles and JavaScript.

Circadian autophagy drives iTRF-mediated longevity

Subjects

Abstract

Time-restricted feeding (TRF) has recently gained interest as a potential anti-ageing treatment for organisms from Drosophila to humans1,2,3,4,5. TRF restricts food intake to specific hours of the day. Because TRF controls the timing of feeding, rather than nutrient or caloric content, TRF has been hypothesized to depend on circadian-regulated functions; the underlying molecular mechanisms of its effects remain unclear. Here, to exploit the genetic tools and well-characterized ageing markers of Drosophila, we developed an intermittent TRF (iTRF) dietary regimen that robustly extended fly lifespan and delayed the onset of ageing markers in the muscles and gut. We found that iTRF enhanced circadian-regulated transcription and that iTRF-mediated lifespan extension required both circadian regulation and autophagy, a conserved longevity pathway. Night-specific induction of autophagy was both necessary and sufficient to extend lifespan on an ad libitum diet and also prevented further iTRF-mediated lifespan extension. By contrast, day-specific induction of autophagy did not extend lifespan. Thus, these results identify circadian-regulated autophagy as a critical contributor to iTRF-mediated health benefits in Drosophila. Because both circadian regulation and autophagy are highly conserved processes in human ageing, this work highlights the possibility that behavioural or pharmaceutical interventions that stimulate circadian-regulated autophagy might provide people with similar health benefits, such as delayed ageing and lifespan extension.

Main

iTRF extends Drosophila lifespan

We tested four TRF schedules, biased to night-time fasting, for lifespan extension (Fig. 1a, Extended Data Fig. 1a). The control diet provided 24-h access to food (ad libitum). The standard TRF schedule (12-h access to food during lights on, 12-h fasting during lights off) did not extend lifespan relative to the control diet unless limited to adult days 10–40 (days post-eclosion); TRF-mediated lifespan extension was modest and inconsistent from trial to trial2,6 (Extended Data Fig. 1b, c). By contrast, 24-h fasting (followed by 1–2 days of ad libitum feeding)6 shortened lifespan, as shown previously6 (Extended Data Fig. 1d). By trial and error, we identified an intermediate feeding schedule that robustly extended lifespan (Fig. 1a). Flies fasted for 20 h every other day, starting at mid-morning (6 h after lights on or Zeitgeber time 6 (ZT6)), with a recovery day of an ad libitum diet between fast days. Although maintaining this diet through old age did not extend lifespan, maintaining this diet for a 30-day window from 10 to 40 days old resulted in consistent, significant lifespan extension (Fig. 1b, Extended Data Fig. 1e, f). Shorter 10-day windows of this diet at different ages (days 10–20, 20–30 or 30–40) extended lifespan incrementally (Extended Data Fig. 2a–e); by contrast, a 10-day window of this diet with older flies (days 40–50) did not extend lifespan (Extended Data Fig. 2f, g). Relative to animals on ad libitum diets, animals on this diet from days 10 to 40 had a mean lifespan increase of more than 18% (female flies) and 13% (male flies); hereafter, our experiments focused on female flies. We term this lifespan-extending dietary regimen iTRF.

Fig. 1: iTRF extends lifespan and healthspan without dietary restriction.
figure 1

a, Schematic of ad libitum (ad lib) and iTRF diets. b, Relative to ad libitum (solid line, n = 142), iTRF (dashed line, n = 205) extended lifespan (P < 0.0001). c, Relative to ad libitum (dark grey dots, n = 13), flies on iTRF have increased average food intake (light grey dots, n = 14). d, iTRF and DR additively extended lifespan (n > 98 for each diet). e, f, iTRF decreased age-related declines in climbing activity (n = 10 vials of 10 flies per genotype per condition per time point) (e) and increased protein aggregation (n = 4 biological replicates of 30 flies per genotype per condition per time point) (f). Ub, ubiquitin. In b, d, e, the light blue boxes on the graphs indicate the duration of iTRF. See Methods and Supplementary Information for trials, statistics and source data; NS = P > 0.05, *P < 0.05, **P < 0.01, ***P < 0.001 and ****P < 0.0001; n refers the number of flies unless otherwise specified; P values were obtained by unpaired, two-tailed t-test (c, f), ANOVA followed by Tukey’s post-hoc test (e), and log-rank analysis (b, d). The centre values are the averages and the error bars indicate s.e.m.

iTRF differs from dietary restriction

We first tested whether iTRF causes caloric restriction, or decreased food intake, which is known to extend lifespan1,7. To test food intake, we measured the feeding rates of flies on ad libitum and iTRF diets over three cycles of fasting and refeeding via the capillary feeder (CaFe) assay8,9. Flies on an iTRF diet exhibited compensatory feeding during the recovery period (Extended Data Fig. 2h), resulting in slightly increased average food consumption over 48 h (fast day plus feed day), relative to control animals on an ad libitum diet (Fig. 1c). Thus, iTRF does not extend lifespan by limiting nutrient intake.

In flies, two established lifespan-extending manipulations are dietary protein restriction (DR) and inhibition of insulin-like signalling10. To test whether iTRF acts via DR to extend lifespan, we titrated protein concentration with either ad libitum or iTRF regimens (Fig. 1d, Extended Data Fig. 2i). If iTRF acts solely via DR, we would not expect iTRF and DR to have additive effects. We found that iTRF and DR can act additively. Thus, iTRF-mediated lifespan extension can function independently of DR-mediated longevity. Similarly, inhibition of insulin-like signalling via ablation of most insulin-producing cells allowed typical iTRF-mediated lifespan extension with similar magnitude to controls (Extended Data Fig. 2j). Together, these results suggest that iTRF-mediated lifespan extension is distinct from lifespan extension due to DR or inhibition of insulin-like signalling.

iTRF extends healthspan

To assess the anti-ageing effects of iTRF, we assayed known age-related changes in muscle/neuronal function, protein aggregation and intestinal function. First, to assess overall muscle/neuronal function, we assayed climbing ability. Flies on iTRF exhibited less age-related decline in climbing ability relative to flies on an ad libitum diet (Fig. 1e). Second, to measure conserved markers of age-related protein aggregation, we extracted Triton-insoluble fractions from whole-fly extracts of flies on iTRF and ad libitum diets both pre-iTRF and post-iTRF intervention (7 and 40 days old) followed by western blot analysis for ubiquitin (Fig. 1f) and the Drosophila orthologue of p62/SQSTM1/ref(2)P (hereafter referred to as p62) (Extended Data Fig. 3a, b). For both markers, flies on iTRF had decreased levels in the insoluble fraction relative to control (ad libitum) flies, demonstrating less ageing-related protein aggregation. Third, we directly measured protein aggregation in muscle using anti-polyubiquitin and anti-p62 antibodies with confocal immunofluorescence microscopy. Again, relative to controls on an ad libitum diet, iTRF significantly decreased the number and area of polyubiquitin and p62 aggregates in the flight muscle of aged flies (Extended Data Fig. 3c–e). Fourth, because decreased intestinal function is another conserved marker of ageing, we measured ageing-related intestinal stem cell over-proliferation, intestinal integrity and intestinal microbial load. iTRF decreased these intestinal ageing markers relative to controls on an ad libitum diet (Extended Data Fig. 3f–h). Finally, because diet affects intestinal microorganisms, which impact ageing, we tested whether iTRF-mediated lifespan extension depends on fly-associated microorganisms. Treatment with antibiotics during both fasting and feeding phases depleted associated microorganisms to nearly non-detectable levels (Extended Data Fig. 3h); iTRF caused the same lifespan extension in antibiotic-treated flies as vehicle controls, suggesting that iTRF-mediated lifespan extension does not depend on fly-associated microorganisms (Extended Data Fig. 3i, j). Together, these results demonstrate that iTRF decreased multiple ageing parameters relative to controls on an ad libitum diet and suggest that iTRF extends lifespan by increasing healthspan and delaying ageing.

iTRF requires an intact circadian clock

Because iTRF does not alter dietary composition but controls the timing of feeding, we examined the role of circadian clock components, which regulate the timing of physiological functions. Circadian clock components are highly conserved among animals11,12 and regulate 24-h oscillations in transcription, which underlie 24-h oscillations in physiology and behaviour13,14. The core circadian clock components form a transcriptional negative-feedback loop15: in Drosophila, Clock (Clk) and Cycle (Cyc) proteins activate the transcription of hundreds of genes, including many metabolic genes3,7, and the circadian regulators period (per) and timeless (tim), whose gene products inhibit the activity of Clk and Cyc (Fig. 2a).

Fig. 2: Core circadian clock components are required for iTRF-mediated lifespan and healthspan extension.
figure 2

a, Schematic of the core circadian clock. b, c, Relative to an ad libitum diet (solid line), iTRF (dashed line) enhanced circadian expression of Clk (b) and per (c) during fasting (n = 4 biological replicates of 30 flies per condition per time point; unmarked is NS). d, e, Relative to an ad libitum diet (solid lines), iTRF (dashed lines) extended the lifespans of controls (Ctrl; grey; ad libitum n = 145–199, iTRF n = 231–262) but not Clkjrk mutants (red; ad libitum n = 143, iTRF n = 196) (d), nor timCRISPR mutants (yellow; ad libitum n = 228; iTRF n = 262) and perCRISPR mutants (orange; ad libitum n = 179, iTRF n = 192) (e). f, In contrast to night-biased iTRF (left graph, dashed grey line; n = 322), day-biased iTRF (right graph, dashed grey line; n = 286) did not extend lifespan relative to the ad libitum diet (solid grey line; n = 553); per01 mutants (orange lines) were not affected by night-biased or day-biased iTRF (n = 209–218). g, h, Relative to an ad libitum diet (solid line or dark shade), iTRF (dashed line or light shade) inhibited two ageing markers in controls (grey lines) but not in per01 mutants (orange lines): declines in climbing activity (n = 10 vials of 10 flies per genotype per condition per time point) (g); and increased protein aggregation (n = 4 biological replicates of 30 flies per genotype per condition per time point) (h). In dg, the light blue boxes on the graphs indicate the duration of iTRF. See Methods and Supplementary Information for trials, statistics and source data; NS = P > 0.05, **P < 0.01, ***P < 0.001 and ****P < 0.0001; n refers to the number of flies unless otherwise specified; P values were obtained by ANOVA followed by Tukey’s post-hoc test (b, c, g, h) and log-rank analysis (df). The centre values are the averages and the error bars indicate s.e.m.).

Others have shown that TRF regimens enhance circadian gene expression1,3,16,17,18,19,20. To confirm this effect with iTRF, we performed quantitative real-time PCR (qRT–PCR) analysis of animals on ad libitum and iTRF diets every 4 h for 48 h. iTRF broadened the daytime peak of clock (Clk) expression (Fig. 2b) and increased the amplitude of per and tim gene expression, specifically during the night/fasting phase (Fig. 2c, Extended Data Fig. 4a). Thus, similar to other TRF regimens, iTRF enhances circadian gene expression.

To test whether circadian clock components are required for iTRF-mediated lifespan extension, we compared several arrhythmic circadian mutants and their genetic controls on ad libitum and iTRF diets: Clkjrk, cyc01, per01 and tim01 mutants and mutants with CRISPR-mediated disruption of per (perCRISPR) or tim (timCRISPR)21,22 (Fig. 2d, e, Extended Data Fig. 4b, c). While genetic controls exhibited significant lifespan extension on iTRF, circadian mutants did not. As shown previously, per01 and cyc01 mutants responded normally to DR23 (Extended Data Fig. 4d, e). Starvation and feeding assays confirmed that, like controls, per01 mutants did not die during or after 20-h fast periods and compensated for fast periods with increased feeding22,23 (Extended Data Fig. 4f, g). Together, our results suggest that iTRF-mediated lifespan extension requires a functional circadian clock.

To test whether iTRF-mediated lifespan extension requires a night-biased fast period, we tested day-biased iTRF, shifted by 12 h (ZT18–ZT14 the following day), with mainly daytime fasting. While night-biased iTRF significantly extended lifespan relative to controls on an ad libitum diet, day-biased iTRF did not (Fig. 2f). per01 mutants were unaffected by either iTRF regimen. This result suggests that night-biased fasting is required for iTRF lifespan extension.

To test whether iTRF-mediated healthspan extension is dependent on the circadian clock, we measured climbing ability and ubiquitylated protein accumulation for young and old per01 mutants and genetic controls on iTRF or ad libitum diets. While iTRF preserved climbing ability and lowered ubiquitylated protein levels in controls relative to those on ad libitum diets, per01 mutants did not respond to iTRF and exhibited ageing-related declines in climbing ability and increased protein aggregation similar to per01 mutants on an ad libitum diet (Fig. 2g, h, Extended Data Fig. 4h, i). Thus, iTRF-mediated lifespan and healthspan extension require a functional circadian clock and night-biased fasting.

iTRF requires autophagy components

Because TRF involves fasting, we examined the role of autophagy, a starvation-induced cellular process to recycle macromolecules24,25 (Fig. 3a). We first used qRT–PCR to test whether two conserved autophagy mediators, Atg1 and Atg8a (the mammalian homologues of ULK1 and LC3, respectively), are circadian-regulated in Drosophila. Consistent with other model organisms and cell culture results26,27, both atg1 and atg8a were circadian-regulated in flies, with night-time expression peaks (Fig. 3b, c, solid lines). Similar to circadian genes, iTRF enhanced night-time expression of atg1 and atg8a in controls (Fig. 3b, c, dashed lines) but not in per01 mutants (Extended Data Fig. 5a, b). Thus, expression of two key autophagy genes is circadian-regulated and enhanced by iTRF.

Fig. 3: Autophagy mediators are required for iTRF-mediated lifespan extension.
figure 3

a, Schematic of core autophagy mediators. PE, phosphatidylethanolamine. b, c, atg1 and atg8a expression were circadian-regulated; iTRF (dashed line) enhanced night-peaking atg1 (b) and atg8a (c) expression relative to the ad libitum diet (solid line); each n = 4 biological replicates of 30 flies per condition per time point (unmarked is NS). d, iTRF (light grey) increased the ratio of free mCherry (mCh) to mCherry–Atg8a in controls relative to ad libitum (dark grey) and, to a lesser extent, in per01 mutants (ad libitum, orange; iTRF, light orange); each n = 4 biological replicates of 30 flies per genotype per condition. e, LysoTracker (magenta), GFP–Atg8a (green) and DNA (blue) staining revealed that control iTRF flies had increased autolysosomes in their intestines (light grey; n = 8 guts) compared with per01 mutants (light orange; n = 8 guts). fh, The light blue boxes on graphs indicate the duration of iTRF. Relative to an ad libitum diet (solid lines), iTRF (dashed lines) extended the lifespans of controls (vehicle (Veh), grey; ad libitum n = 195 (f), n = 169 (g)); iTRF n = 263 (f), n = 238 (g)), but not flies with RNAi-mediated knockdown of atg1 (pink; ad libitum n = 158, iTRF n = 179) (f) or atg8a (purple; ad libitum n = 151, iTRF n = 152) (g) in control backgrounds or in per01 backgrounds (per01 mutant, orange; ad libitum n = 161, iTRF n = 167; per01 mutant with atg1-RNAi, hot pink; ad libitum n = 169, iTRF n = 174) (h). See Methods and Supplementary Information for trials, statistics and source data; n refers to the number of flies unless otherwise specified; NS = P > 0.05, *P < 0.05, **P < 0.01, ***P < 0.001 and ****P < 0.0001; P values were obtained by ANOVA followed by Tukey’s post-hoc test (bd), unpaired, two-tailed t-test (e) and log-rank analysis (fh). The centre values are the averages and the error bars indicate the s.e.m.).

To test whether iTRF induces autophagy, we measured signalling markers of autophagy, autophagic flux and autophagosome/autolysosome formation. We compared genetic controls and per01 mutants on iTRF and ad libitum diets, predicting that, if autophagy is a key circadian-regulated function in iTRF, per01 mutants would not respond. We first examined two signalling markers associated with autophagy induction: increased AMPK phosphorylation and decreased S6K phosphorylation28. Consistent with iTRF-enhanced circadian-regulated autophagy, iTRF fasting periods increased phospho-AMPK and decreased phospho-S6K levels relative to ad libitum diets for genetic controls but not per01 mutants (Extended Data Fig. 5c, d). Next, we measured autophagic flux in control and per mutants on both ad libitum and iTRF diets using mCherry-tagged Atg8. The ratio of free mCherry to mCherry–Atg8a reflects autophagic activity because Atg8a is rapidly destroyed in the lysosome during autophagy while mCherry is more stable29,30. iTRF induced high levels of autophagy in controls relative to the ad libitum diet and significantly less in per01 mutants (Fig. 3d). Finally, we directly monitored autophagosome formation, lysosome abundance and autolysosome formation in the intestine via live fluorescence imaging of the autophagosome marker GFP–Atg8a relative to the lysosomal marker LysoTracker30,31. iTRF increased active autolysosomes in controls relative to the ad libitum diet but not in per01 mutants (Fig. 3e, Extended Data Fig. 5e). Thus, iTRF induction of autophagy correlates with lifespan extension and depends on the circadian clock.

To determine whether autophagy components are required for iTRF-mediated lifespan extension, we first manipulated autophagy-regulatory AMPK and TOR signalling pathways by driving expression of dominant-negative (DN) or constitutively active (CA) AMPK and S6K32,33. On an ad libitum diet, these known ageing regulators had expected effects, with pro-autophagy manipulations extending lifespan and autophagy inhibition shortening lifespan (Extended Data Fig. 6a–d, solid lines). On iTRF, while DN-S6K did not affect iTRF-mediated lifespan extension, DN-AMPK, CA-AMPK and CA-S6K partially inhibited iTRF-mediated lifespan extension (approximately 10%) relative to controls (more than 18%) (Extended Data Fig. 6a–d, dashed lines). Thus, in contrast to insulin signalling (Extended Data Fig. 2j), manipulation of these autophagy regulatory pathways affected iTRF-mediated lifespan.

To test the role of Atg1 and Atg8a directly, we knocked down atg1 and atg8a expression using UAS-RNA interference (RNAi)-mediated knockdown via a ubiquitous inducible driver (daughterless-GeneSwitch-GAL4 (daGS-GAL4))34. This experiment also tested for developmental effects, as flies were fed the inducing drug RU486 or vehicle control starting at adult day 5. RNAi knockdown of atg1 or atg8a in controls prevented iTRF-mediated lifespan extension (Fig. 3f, g) and atg1 knockdown in per01 mutants had no effect (Fig. 3h). RU486 feeding alone did not affect lifespan extension of flies lacking UAS-RNAi transgenes (Extended Data Fig. 6e, f). Together, these data suggest that activation of autophagy is necessary for iTRF-mediated longevity.

iTRF requires circadian autophagy

To test whether circadian manipulation of autophagy impacts iTRF-mediated health benefits, we exploited circadian promoters and the UAS-GAL4 system35 (Fig. 4a). We used per-GAL4 and tim-GAL4 (ref. 35) to drive high night-time and low daytime expression of RNAi constructs against atg1 and atg8a, respectively, confirming gene and protein expression by qRT–PCR and western blot analysis (Fig. 4b, Extended Data Fig. 7a). Flies with night-time RNAi knockdown of atg1 or atg8a did not respond to iTRF (Extended Data Fig. 7b, c), suggesting that night-time atg1 and atg8a expression are required for iTRF-mediated lifespan extension.

Fig. 4: Increasing circadian-regulated expression of autophagy-promoting genes is sufficient for the health benefits of iTRF.
figure 4

a, Schematic of the genetic method to knockdown (or overexpress) autophagy components with circadian rhythmicity. b, per-GAL4-driven atg1 expression (magenta line) enhanced circadian, night-peaking atg1 gene expression (grey line); each n = 4 biological replicates of 30 flies per genotype per time point (unmarked is NS). c, d, Relative to controls (solid grey line, n = 169–206), genetic circadian overexpression (OE) of atg1 (solid magenta line; n = 139) (c) or atg8a (solid purple line; n = 191) (d) caused lifespan extension on an ad libitum diet (solid lines) similar to controls on iTRF (dashed grey lines, n = 139–263) that was not further extended by iTRF (atg1, dashed magenta line, n = 141; atg8a, dashed purple line, n = 228). e, Schematic of pharmacological methods to overexpress atg1 at different times of the day. f, RU486 (RU)-induced atg1 overexpression at night extended lifespan of flies on an ad libitum diet (solid magenta line, n = 197) relative to controls on an ad libitum diet (solid grey line, n = 186), extending lifespan similar to controls on iTRF (dashed grey line, n = 232) and was not further extended by iTRF (dashed magenta line, n = 329). g, atg1 overexpression extended lifespan less in per01 mutants (per: ad libitum, solid orange line, n = 192; iTRF, dashed orange line, n = 245; per with night atg1 overexpression: ad libitum, solid pink line, n = 225; iTRF, dashed pink line, n = 345). h, i, Relative to controls on an ad libitum diet (solid grey line, n = 208), shifted TRF controls (dashed grey line, n = 363) and 12-h RU-induced overexpression of atg1 (solid magenta line, n = 236–290) extended lifespan non-additively (dashed magenta line, n = 192–341) during the night phase (h) but not during the day phase (i). In c, d, fi, the light blue boxes on graphs indicate the duration of iTRF (sky blue) or TRF (aqua) diets. See Methods and Supplementary Information for trials, statistics and source data; n indicates the number of flies unless otherwise specified; NS = P > 0.05, *P < 0.05, ***P < 0.001 and ****P < 0.0001; P values were obtained by ANOVA followed by Tukey’s post-hoc test (b), and log-rank analysis (c, d, fi). The centre values are the averages and the error bars indicate s.e.m.).

Because increased autophagy is known to extend lifespan24, we tested whether circadian-regulated induction of autophagy with per-GAL4 and tim-GAL4, driving atg1 and atg8a, respectively, is sufficient for iTRF lifespan extension. The stronger tim-GAL4 driver induced early lethality in combination with atg1 (ref. 36). Flies with night-specific overexpression of atg1 or atg8a not only exhibited iTRF-like lifespan extension on an ad libitum diet but also exhibited no additional lifespan extension on iTRF (Fig. 4c, d). This suggests that, if circadian-regulated autophagy is already enhanced, iTRF has no effect. tim-GAL4-driven mCherry-tagged Atg8a expression had similar results (Extended Data Fig. 7d), and western blot analysis confirmed circadian oscillation of protein levels as well as induction of autophagy (Extended Data Fig. 7a). These results suggest that enhancing circadian-regulated autophagy is a major mechanism driving iTRF-mediated lifespan extension.

To confirm that lifespan extension reflects delayed ageing, we tested atg1 RNAi and overexpression mutants and controls on ad libitum and iTRF diets for age-related declines in climbing ability and increased protein aggregation. Consistent with circadian atg1 requirement for lifespan extension, circadian knockdown of atg1 prevented iTRF-mediated healthspan extension (Extended Data Fig. 8a, b). Similarly, circadian overexpression of atg1 caused iTRF-like healthspan extension in flies on an ad libitum diet, with no additional improvement on iTRF (Extended Data Fig. 8c, d). This suggests that circadian expression of atg1 is both necessary and sufficient for iTRF-mediated lifespan and healthspan extension.

To pharmacologically enhance circadian-regulated expression, we used the RU486-inducible daGS-GAL4 to overexpress atg1 in flies on an ad libitum diet during the night/fasting phase (Fig. 4e, Extended Data Fig. 9a). Similar to per-GAL4 driving atg1, night-specific RU486-induced overexpression of atg1 was sufficient for iTRF-like lifespan extension on the ad libitum diet and inhibited further lifespan extension on iTRF (Fig. 4f). RU486-induced atg1 overexpression in per01 mutants, which normally have lower iTRF-induced autophagy gene expression and function (Fig. 3d, e, Extended Data Fig. 5a–e), caused modest lifespan extension on both ad libitum and iTRF diets (Fig. 4g), suggesting that atg1 expression in per01 mutants was not by itself sufficient for full response to iTRF.

Because night-specific RU486-induced autophagy was sufficient for iTRF-like lifespan extension, we tested day-specific RU486-induced autophagy. We developed a night-biased shifted 12:12 TRF regimen with 12-h fast (ZT9–ZT21) and 12-h feeding (ZT21–ZT9), without recovery days; the 3-h offset from lights off removed the evening meal and allowed sufficient fasting for robust lifespan extension similar to iTRF (Fig. 4e). Similar to this shifted 12:12 TRF, night-specific 12-h RU486 induction of atg1 (ZT9–ZT21) produced iTRF-like lifespan extension that resisted further TRF lifespan extension (Fig. 4h). By contrast, day-specific fasting and/or RU486 treatment (ZT21–ZT9) did not extend lifespan (Fig. 4i). per01 mutants did not respond to shifted TRF (Extended Data Fig. 9b, c). These data suggest that night-specific enhanced atg1 expression is both necessary and sufficient for iTRF-mediated lifespan extension (Extended Data Fig. 9d). Together, our results support the hypothesis that clock-dependent enhancement of macroautophagy mediates the effects of iTRF-mediated lifespan extension.

Both circadian regulation and autophagy control ageing and lifespan28,37. Here we identified circadian clock components (Tim, Per, Cyc and Clk) and essential autophagy components Atg1 and Atg8a as both necessary and sufficient for the anti-aeging, lifespan-extending benefits of iTRF. While a previous mouse study had found that TRF-mediated protection against high-fat diet did not require the circadian clock, a recent fly study confirmed our finding that iTRF-mediated lifespan extension requires a functional circadian clock38. With a diversity of cellular autophagy targets (proteins, lipids, nucleotides and organelles), identifying the major tissues and specific targets involved in iTRF-mediated, autophagy-associated health benefits are challenges for future work. Ageing is a major risk factor for mortality, triggering pathological processes that contribute to metabolic, cardiovascular and neurodegenerative diseases. As a simple dietary intervention strategy, iTRF appears to be both efficient and pleiotropic, with health benefits for multiple tissues, and offers a potential method of choice to combat ageing.

Methods

Fly strains

w1118 Canton-S (CS) were used as a ‘wild-type’ strain throughout this paper. UAS-DN-S6K (6911), UAS-CA-S6K (6914), UAS-DN-AMPK (32112), UAS-CA-AMPK (32110), UAS-atg1-RNAi (44034), UAS-atg8a-RNAi (34340) and UAS-atg1 (51654) were obtained from the Bloomington Stock Center and outcrossed to CS for at least 10 generations. tubulin-GAL4 flies were obtained from J. Carlson, UAS-mCh-atg8a and UAS-GFP-atg8a from E. Baehrecke, and daGS from D. W. Walker; all were outcrossed to CS for at least 10 generations. period (per01) mutants, timeless-GAL4 and period-GAL4 were obtained from J. Giebultowicz and, because they were last outcrossed many years ago, were outcrossed to CS for 12 generations in the past 2 years. UAS-gRNA and UAS-CAS9 lines were those utilized in our previous papers and were outcrossed to CS for five generations22,39. Previously outcrossed cycle (cyc01) mutants were obtained from S. Syed with a CS control strain. All experiments with multiple transgenes used flies that had undergone 12 generations of out-crossing into a CS control and/or per01, CS mutant background.

Fly media

Developmental media consisted of standard yeast-cornmeal-agar media (Archon Scientific, glucose recipe: 7.6% w/v glucose, 3.8% w/v yeast, 5.3% w/v cornmeal, w/v 0.6% agar, 0.5% v/v propionic acid, 0.1% w/v methyl paraben and 0.3% v/v ethanol). Adult flies that eclosed within a 24-h period were collected and transferred to ‘adult medium’ containing 4% glucose, 2% sucrose, 8% cornmeal, 1% agar, and either 0%, 0.5%, 1%, 2%, 3%, 6% or 10% yeast extract (Difco) supplemented with 1.5% methylparaben mix (10% methylparaben dissolved in ethanol) and 1% propionic acid for lifespan and biochemical analysis. Food for ad libitum, iTRF, TRF and shifted TRF diets was adult medium with 3% yeast extract. All percentages are given in w/v except the methylparaben mix, and propionic acid is given in v/v. Fasting media consisted of 1% agar in ddH2O made fresh daily. Food for activity recording CAFE (ARC) assays is described below.

Drug supplementation in media for lifespan

All drugs were supplemented into cooled (65 °C) liquid adult medium (containing 3% yeast extract) following preparation to the following final concentration(s); for RNAi experiments, RU486 (Cayman Chemical) was dissolved in ethanol and supplemented into medium after day 5 post-eclosion at a final concentration of 100 μg/ml; vehicle controls were supplemented with the same volume of ethanol alone. Timed RU486 feeding of daGS>UAS-atg1 consisted of flies being fed 0.5 μg/ml in standard adult media or fasting media only during the fasting phase, then flipped to vehicle control food the following morning only from days 10 to 40 of adulthood. Vehicle-only controls were flipped at the same time for consistency. For gut microorganism clearance, the medium contained 500 μg/ml ampicillin, 50 μg/ml tetracycline and 200 μg/ml rifamycin in 50% ethanol and the same volume of 50% ethanol alone was used as the vehicle control.

Lifespan analysis

Drosophila were reared from embryos in low-density bottles with standard yeast-cornmeal-agar media listed above (Archon Scientific). Newly eclosed flies (approximately 24 h post-eclosion) were collected onto adult medium with 3% yeast extract and allowed to mate for 48 h. Female and male flies were separated and maintained at a density of 30–35 flies per vial in a humidified (65%), temperature-controlled (25 °C) incubator with a 12-h light–dark cycle. All flies were raised on ad libitum conditions until day 10 post-eclosion upon which flies were placed on various feeding regimes (Extended Data Fig. 1a). For consistency, ad libitum control flies were flipped on to fresh food at the same time as experimental diet flies were transferred to fasting media, and once again when fasting flies were flipped on to regular adult media. Death was scored at time of flipping, and lifespan was compared by log-rank analysis.

ARC assay

Feeding data from individual flies were collected as previously described9,40. Feeding medium was a solution of 4% dextrose, 2% sucrose and 3% yeast extract in ddH2O, filtered (with a 0.2-µm cellulose acetate sterile syringe filter; VWR). Flies were transferred to fresh standard medium every other day until the experiment. When the flies were 9–11 days old, the animals were loaded by mouth pipette into standard ARC chambers and allowed to acclimate overnight (approximately 18 h) with access to the test diet in a glass capillary pipette. The capillaries were replaced daily with those containing fresh food or ddH2O. The meniscus level of each capillary was tracked for the entire duration of the feeding periods at 1-s intervals. Drops in meniscus position above a pre-calibrated threshold were considered feeding events, and feeding bouts less than 2 min apart were considered to be part of the same meal. The volume consumed from each feeding event was automatically calculated and collated with a custom Python code9,40.

Intestinal barrier dysfunction ‘smurf’ assay

The ‘smurf fly’ intestinal barrier dysfunction assay was performed as previously described41,42. Flies were aged on standard adult medium (see ‘Fly media’) until the day of the smurf assay. Dyed medium was prepared by the addition of FD&C Blue No. 1 at a final concentration of 2.5% w/v. A fly was counted as a smurf when dye colouration was observed outside the digestive tract. Comparisons of smurf proportion per time point were carried out using binomial tests to calculate the probability of having as many smurfs in population A as in population B, as well as analysis of variance (ANOVA) for proportions of smurf flies per replicate vial with a minimum of 7 vials of 12–31 flies per replicate.

qRT–PCR

Female flies (35 days old) on either ad libitum or iTRF conditions were collected for RNA extraction over the course of 48 h in 4-h intervals. Four biological replicates of 30 female flies per time point and feeding regimen were snap-frozen in liquid nitrogen and stored at −80 °C. RNA was extracted using TRIzol (Invitrogen) following the manufacturer’s protocol. Samples were treated with DNaseI (Invitrogen), then heat inactivated. cDNA was synthesized by the Revertaid First Strand cDNA Synthesis Kit (Thermo Scientific). PowerUp SYBR Mastermix (Applied Biosystems) was used to perform qRT–PCR using a CFX-Connect thermal cycler (Bio-Rad). Primer efficiency and relative quantification of transcripts were determined using a standard curve of serial diluted cDNA. Transcripts were normalized using Act5C as a reference gene. The Jonckheere–Terpstra–Kendall (JTK) algorithm was applied using the JTK-Cycle package in R software43 to determine significance of rhythmic cycling. Differences between individual time points were determined by ANOVA followed by multiple comparison tests.

qRT–PCR primers: period (forward): GGTTGCTACGTCCTTCTGGA; period (reverse): TGTGCCTCCTCCGATATCTT; timeless (forward): CCGTGGACGTGATGTACCGCAC; timeless (reverse): CGCAATGGGCATGCGTCTCTG; clock (forward): GGATAAGTCCACGGTCCTGA; clock (reverse): CTCCAGCATGAGGTGAGTGT; atg1 (forward): GCTTCTTTGTTCACCGCTTC; atg1 (reverse): GCTTGACCAGCTTCAGTTCC; atg8a (forward): AGTCCCAAAAGCAAACGAAG; atg8a (reverse): TTGTCCAAATCACCGATGC; actin5C (forward): TTGTCTGGGCAAGAGGATCAG; actin5C (reverse): ACCACTCGCACTTGCACTTTC; 16Sr (forward): AGAGTTTGATCCTGGCTCAG; 16Sr (reverse): CTGCTGCCTYCCGTA.

Microbial load quantification

For 16S bacterial rDNA quantification, 4 replicates of 10 whole flies (washed twice in 70% ethanol and twice in PBS) were used for total DNA extraction via the Power Soil DNA isolation kit (Qiagen). Universal primers for the 16S ribosomal RNA gene were against variable regions 1 (V1F) and 2 (V2R), as previously published44.

Western blot analysis

Whole-body lysates of female flies (30 flies per genotype per condition per time point) were separated by SDS–PAGE using standard procedures. Membranes were probed with antibodies against AMPK phospho-T184 at 1:1,000 dilution (40H9, Cell Signaling), anti-phospho-S6K T398 (9209, Cell Signaling), mCherry (E5D8F, Cell signaling) and horseradish peroxidase (HRP)-conjugated monoclonal mouse anti-actin antibody at 1:5,000 dilution (A3854, Sigma-Aldrich). Rabbit antibodies were detected using HRP-conjugated anti-rabbit IgG antibodies at 1:2,000 dilution (7074, Cell Signaling). Mouse antibodies were detected using HRP-conjugated anti-mouse IgG antibodies at 1:2,000 dilution (7076, Cell Signaling). ECL chemiluminescence reagent (Pierce) was used to visualize HRP activity and detected by a CCD camera Bio-Rad image station. A minimum of four independent samples of each condition were used for statistical analysis and quantification.

Immunostaining of indirect flight muscle

Immunofluorescence was performed as previously described45. Hemithoraces were dissected and fixed for 20 min in PBS with 4% paraformaldehyde and 0.1% Triton X-100. After washing, samples were incubated overnight at 4 °C with an antibody against poly-ubiquitylated proteins, the mouse monoclonal antibody FK2 (Enzo) and anti-P62 rabbit ab178440 (Abcam) at 1:200 dilutions, then washed thoroughly and incubated with secondary anti-mouse AlexaFluor-488 (1:250), anti-rabbit AlexaFluor-555 (1:250) and phalloidin AlexaFluor-647 (1:150) (all Invitrogen). Samples were rinsed three times in PBS with 0.1% Triton X-100 for 10 min at room temperature, then mounted in Prolong Gold (Invitrogen) and imaged via confocal microscopy using ×20 dry objective with 0.5 numerical aperture (NA) (LSM-800 Zeiss, standard laser lines: 405, 488, 561 and 640 nm). Identical laser power settings and photomultiplier values were used for imaging between conditions. For quantification of protein aggregates of hemithoraces, the size and area of protein aggregates were measured using ImageJ particle counter software (ImageJ version 2.0.0-rc-69/1.52p)46. Statistical analysis was conducted using a two-tailed, unpaired Student’s t-test or ANOVA followed by Tukey’s multiple comparisons (n ≥ 9 thoraces per condition).

Climbing activity

Assessment of climbing ability was performed as previously described47 with minor modifications. Briefly, 10 flies were transferred to an empty standard 23 mm × 95 mm plastic vial and then gently tapped to the bottom. The number of flies that reached the top quarter of the vial within 20 s was then scored as climbing. Each experiment was performed on a minimum of 8 vials of 10 flies per condition repeated three times.

LysoTracker Red staining

Female flies (35 days old) near the end of a 20-h fasting phase were anaesthetized on ice and intestines were dissected in cold PBS. Intestines were washed once in PBS, followed by three 30-s rinses in freshly prepared 1 μM LysoTracker Red, (Invitrogen) and 1.5 µg/ml Hoechst stain in PBS at room temperature. Intestines were washed five times for 30 s in PBS at room temperature, then mounted in Vectashield (Vector Labs) and imaged immediately. Imaging was conducted using a ×63 oil objective with 1.4 NA on a Zeiss LSM-800 with standard laser lines (405, 488, 561 and 640 nm) and using identical power settings between samples. Imaging should not proceed for very long as apoptosis can be observed after approximately 60 min. Colocalization GFP–Atg8a quantification was conducted in the COLOC2 plugin for ImageJ (ImageJ version 2.0.0-rc-69/1.52p)46. The number of vesicles with significant LysoTracker and GFP–Atg8a colocalization determined by significant Pearson’s correlation coefficient was then counted using the ImageJ46 particle counter tool (ImageJ version 2.0.0-rc-69/1.52p). Similarly, the total number of LysoTracker-labelled and GFP–Atg8a vesicles was determined using the ImageJ46 particle counter tool (ImageJ version 2.0.0-rc-69/1.52p). Statistical analysis was conducted using a two-tailed, unpaired Student’s t-test.

Triton-insoluble protein extracts

Flies were homogenized in ice-cold PBS with 1% Triton X-100 and protease inhibitor cocktail (Roche). The mixture was spun for 10 min at 4 °C, and the pellet and supernatant were collected. The Triton X-100-insoluble pellet was washed in one additional volume of Triton X-100 solution and resuspended in denaturing lysis solution with 5% lithium dodecyl sulfate (LDS) containing 300 mM dithiothreitol (NuPAGE LDS Sample Buffer; Invitrogen). n = 4 independent samples of 30 flies were used for post-western blot densitometry analysis.

Phospho-histone H3 immunostaining

Briefly, flies were anaesthetized on ice and intestines were dissected in cold PBS. Samples were then fixed in PBS plus 0.1% Triton X-100 containing 4% paraformaldehyde at room temperature for 30 min and rinsed three times in PBS plus 0.1% Triton X-100 for 10 min at room temperature. Blocking was performed in 5% BSA in PBS plus 0.1% triton X-100 for 1 h at room temperature. Primary antibody, anti-phospho-histone H3 (S10) (9701, Cell Signaling), was added at 1:250 in 5% BSA in PBS plus 0.1% Triton X-100 and incubated overnight at 4 °C rotating. After washing three times in PBS plus 0.1% Triton X-100 secondary antibody, anti-rabbit AlexaFluor-488 (Invitrogen) was added at 1:250 dilution with 1.5 µg/ml Hoechst stain (Thermo) in 5% BSA in PBS plus 0.2% Triton X-100 and incubated overnight at 4 °C rotating. After washing, intestines were then mounted in Vectashield mounting medium (Vector Labs) and imaged using a ×20 dry objective on a Zeiss LSM-800 with 0.5 NA and standard laser lines (405, 488, 561 and 640 nm) and using identical power settings between samples. Phospho-histone H3-positive cells were quantified using the ImageJ46 local maxima tool, with identical thresholding for all images (ImageJ version 2.0.0-rc-69/1.52p). Phospho-histone H3 numbers were normalized to the area of the posterior midgut imaged. A minimum of eight intestines were used for each quantification.

Statistical analysis and replicability

Initial lifespan screens were blinded to researchers by number assignment.  Repeat experiments were not blinded, but mortality values were counted by impartial undergraduate researchers. Prism7 (GraphPad) was used to perform the statistical analysis. Significance is expressed as P values (NS = P > 0.05, *P < 0.05, **P < 0.01, ***P < 0.001 and ****P < 0.0001). For comparison of two groups, unpaired, two-tailed t-test was used, when data met criteria for parametric analysis (normal distribution and similar variance). For comparison of more than two groups, ANOVA with Bonferroni, or Tukey’s post-hoc test was performed. Kruskal–Wallis with Dunn’s post-hoc analysis was used for non-parametric data. All plotted values represent means, with error bars representing s.e.m. All biochemical experiments were performed with a minimum of four biological replicates, repeated in two to three independent trials. For comparison of survival curves, log-rank (Mantel–Cox) analysis was used. For ad libitum versus iTRF (day 10–40) comparisons on 3% yeast extract, control flies (w1118, Canton S) were tested nine times, either as experimentals or as controls for other experiments (Figs. 1b, d, 2d, plus two repeats, 2f, Extended Data Figs. 3j, 4c plus repeat, Extended Data Fig. 4e). per01 mutants were tested four times (Fig. 2f, Extended Data Fig. 4c plus repeat, Extended Data Fig. 4e); per and tim CRISPR mutants were each tested twice (Fig. 2e plus repeat), clkJRK mutants were tested three times (Fig. 2d plus two repeats) and cyc01 mutants were tested four times (Extended Data Fig. 4b plus two repeats, Extended Data Fig. 4e). All other lifespans with genetic manipulations were tested two times, with the exception of large screens of alternative diets such as protein titrations (Fig. 1d, Extended Data Fig. 4d, e), alternative TRFs (Extended Data Fig. 1b–f), time windows for iTRF (Extended Data Fig. 2a–g), antibiotic treatment (Extended Data Fig. 3i, j), or night versus day bias (Figs. 2f, 4h, i, Extended Data Fig. 9b, c), as well as mCherry–Atg8 controls (Extended Data Fig. 7d) and daGS driver controls (Extended Data Fig. 6g, g), which were tested once. Titration of protein and lifespan with per01 mutants has been previously published23. See Supplementary Table 1 for details of all lifespan trials and Supplementary Table 2 for raw source data.

Reporting summary

Further information on research design is available in the Nature Research Reporting Summary linked to this paper.

Data availability

The authors declare that all data supporting the findings of this study are available, including replicate experiments, and will be made available on reasonable request from the corresponding author.

References

  1. Longo, V. D. & Panda, S. Fasting, circadian rhythms, and time-restricted feeding in healthy lifespan. Cell Metab. 23, 1048–1059 (2016).

    CAS  PubMed  PubMed Central  Google Scholar 

  2. Villanueva, J. E. et al. Time-restricted feeding restores muscle function in Drosophila models of obesity and circadian-rhythm disruption. Nat. Commun. 10, 2700 (2019).

    ADS  CAS  PubMed  PubMed Central  Google Scholar 

  3. Chaix, A., Zarrinpar, A., Miu, P. & Panda, S. Time-restricted feeding is a preventative and therapeutic intervention against diverse nutritional challenges. Cell Metab. 20, 991–1005 (2014).

    CAS  PubMed  PubMed Central  Google Scholar 

  4. Gill, S., Le, H. D., Melkani, G. C. & Panda, S. Time-restricted feeding attenuates age-related cardiac decline in Drosophila. Science 347, 1265–1269 (2015).

    ADS  CAS  PubMed  PubMed Central  Google Scholar 

  5. de Cabo, R. & Mattson, M. P. Effects of intermittent fasting on health, aging, and disease. N. Engl. J. Med. 381, 2541–2551 (2019).

    PubMed  Google Scholar 

  6. Catterson, J. H. et al. Short-term, intermittent fasting induces long-lasting gut health and TOR-independent lifespan extension. Curr. Biol. 28, 1714-1724.e4 (2018).

    CAS  PubMed  PubMed Central  Google Scholar 

  7. Manoogian, E. N. C. & Panda, S. Circadian rhythms, time-restricted feeding, and healthy aging. Ageing Res. Rev. 39, 59–67 (2017).

    PubMed  Google Scholar 

  8. Ja, W. W. et al. Prandiology of Drosophila and the CAFE assay. Proc. Natl Acad. Sci. USA 104, 8253–8256 (2007).

    ADS  CAS  PubMed  PubMed Central  Google Scholar 

  9. Murphy, K. R., Park, J. H., Huber, R. & Ja, W. W. Simultaneous measurement of sleep and feeding in individual Drosophila. Nat. Protoc. 12, 2355–2366 (2017).

    CAS  PubMed  PubMed Central  Google Scholar 

  10. Partridge, L., Alic, N., Bjedov, I. & Piper, M. D. W. Ageing in Drosophila: the role of the insulin/Igf and TOR signalling network. Exp. Gerontol. 46, 376–381 (2011).

    CAS  PubMed  PubMed Central  Google Scholar 

  11. Cox, K. H. & Takahashi, J. S. Circadian clock genes and the transcriptional architecture of the clock mechanism. J. Mol. Endocrinol. 63, R93–R102 (2019).

    CAS  PubMed  PubMed Central  Google Scholar 

  12. Dunlap, J. C. & Loros, J. J. Making time: conservation of biological clocks from fungi to animals. Microbiol Spectr. 5, FUNK-0039-2016 (2017).

    Google Scholar 

  13. Allada, R. & Chung, B. Y. Circadian organization of behavior and physiology in Drosophila. Annu. Rev. Physiol. 72, 605–624 (2010).

    CAS  PubMed  PubMed Central  Google Scholar 

  14. Panda, S. Circadian physiology of metabolism. Science 354, 1008–1015 (2016).

    ADS  CAS  PubMed  PubMed Central  Google Scholar 

  15. Duong, H. A., Robles, M. S., Knutti, D. & Weitz, C. J. A molecular mechanism for circadian clock negative feedback. Science 332, 1436–1439 (2011).

    ADS  CAS  PubMed  Google Scholar 

  16. Xu, K., Zheng, X. & Sehgal, A. Regulation of feeding and metabolism by neuronal and peripheral clocks in Drosophila. Cell Metab. 8, 289–300 (2008).

    CAS  PubMed  PubMed Central  Google Scholar 

  17. García-Gaytán, A. C. et al. Synchronization of the circadian clock by time-restricted feeding with progressive increasing calorie intake. Resemblances and differences regarding a sustained hypocaloric restriction. Sci. Rep. 10, 10036 (2020).

    ADS  PubMed  PubMed Central  Google Scholar 

  18. Kinouchi, K. et al. Fasting imparts a switch to alternative daily pathways in liver and muscle. Cell Rep. 25, 3299–3314.e6 (2018).

    CAS  PubMed  PubMed Central  Google Scholar 

  19. Wang, H. et al. Time-restricted feeding shifts the skin circadian clock and alters UVB-induced DNA damage. Cell Rep. 20, 1061–1072 (2017).

    CAS  PubMed  PubMed Central  Google Scholar 

  20. Yamamuro, D. et al. Peripheral circadian rhythms in the liver and white adipose tissue of mice are attenuated by constant light and restored by time-restricted feeding. PLoS ONE 15, e0234439 (2020).

    CAS  PubMed  PubMed Central  Google Scholar 

  21. Delventhal, R. et al. Dissection of central clock function in Drosophila through cell-specific CRISPR-mediated clock gene disruption. eLife 8, e48308 (2019).

    CAS  PubMed  PubMed Central  Google Scholar 

  22. Ulgherait, M. et al. Circadian regulation of mitochondrial uncoupling and lifespan. Nat. Commun. 11, 1927 (2020).

    ADS  CAS  PubMed  PubMed Central  Google Scholar 

  23. Ulgherait, M. et al. Dietary restriction extends the lifespan of circadian mutants tim and per. Cell Metab. 24, 763–764 (2016).

    CAS  PubMed  PubMed Central  Google Scholar 

  24. Hansen, M., Rubinsztein, D. C. & Walker, D. W. Autophagy as a promoter of longevity: insights from model organisms. Nat. Rev. Mol. Cell Biol. 19, 579–593 (2018).

    CAS  PubMed  PubMed Central  Google Scholar 

  25. Scott, R. C., Schuldiner, O. & Neufeld, T. P. Role and regulation of starvation-induced autophagy in the Drosophila fat body. Dev. Cell 7, 167–178 (2004).

    CAS  PubMed  Google Scholar 

  26. Kalfalah, F. et al. Crosstalk of clock gene expression and autophagy in aging. Aging 8, 1876–1895 (2016).

    CAS  PubMed  PubMed Central  Google Scholar 

  27. Ma, D., Li, S., Molusky, M. M. & Lin, J. D. Circadian autophagy rhythm: a link between clock and metabolism? Trends Endocrinol. Metab. 23, 319–325 (2012).

    CAS  PubMed  PubMed Central  Google Scholar 

  28. Rubinsztein, D. C., Mariño, G. & Kroemer, G. Autophagy and aging. Cell 146, 682–695 (2011).

    CAS  PubMed  Google Scholar 

  29. Chang, J. T., Kumsta, C., Hellman, A. B., Adams, L. M. & Hansen, M. Spatiotemporal regulation of autophagy during Caenorhabditis elegans aging. eLife 6, e18459 (2017).

    PubMed  PubMed Central  Google Scholar 

  30. DeVorkin, L. & Gorski, S. M. Monitoring autophagy in Drosophila using fluorescent reporters in the UAS-GAL4 system. Cold Spring Harb. Protoc. 2014, 967–972 (2014).

    PubMed  Google Scholar 

  31. Ulgherait, M., Rana, A., Rera, M., Graniel, J. & Walker, D. W. AMPK modulates tissue and organismal aging in a non-cell-autonomous manner. Cell Rep. 8, 1767–1780 (2014).

    CAS  PubMed  PubMed Central  Google Scholar 

  32. Mirouse, V., Swick, L. L., Kazgan, N., St Johnston, D. & Brenman, J. E. LKB1 and AMPK maintain epithelial cell polarity under energetic stress. J. Cell Biol. 177, 387–392 (2007).

    CAS  PubMed  PubMed Central  Google Scholar 

  33. Barcelo, H. & Stewart, M. J. Altering Drosophila S6 kinase activity is consistent with a role for S6 kinase in growth. Genesis 34, 83–85 (2002).

    CAS  PubMed  Google Scholar 

  34. Tricoire, H. et al. The steroid hormone receptor EcR finely modulates Drosophila lifespan during adulthood in a sex-specific manner. Mech. Ageing Dev. 130, 547–552 (2009).

    CAS  PubMed  Google Scholar 

  35. Kaneko, M., Park, J. H., Cheng, Y., Hardin, P. E. & Hall, J. C. Disruption of synaptic transmission or clock-gene-product oscillations in circadian pacemaker cells of Drosophila cause abnormal behavioral rhythms. J. Neurobiol. 43, 207–233 (2000).

    CAS  PubMed  Google Scholar 

  36. Plautz, J. D., Kaneko, M., Hall, J. C. & Kay, S. A. Independent photoreceptive circadian clocks throughout Drosophila. Science 278, 1632–1635 (1997).

    ADS  CAS  PubMed  Google Scholar 

  37. Duffy, J. F., Zitting, K.-M. & Chinoy, E. D. Aging and circadian rhythms. Sleep Med. Clin. 10, 423–434 (2015).

    PubMed  PubMed Central  Google Scholar 

  38. Cabrera, D., Young, M. W. & Axelrod, S. Time-restricted feeding prolongs lifespan in Drosophila in a peripheral clock-dependent manner. Preprint at bioRxiv https://doi.org/10.1101/2020.09.14.296368 (2020).

  39. Delventhal, R. et al. Dissection of central clock function in Drosophila through cell-specific CRISPR-mediated clock gene disruption. eLife 8, e48308 (2019).

    CAS  PubMed  PubMed Central  Google Scholar 

  40. Murphy, K. R. et al. Postprandial sleep mechanics in Drosophila. eLife 5, e19334 (2016).

    PubMed  PubMed Central  Google Scholar 

  41. Rera, M., Clark, R. I. & Walker, D. W. Intestinal barrier dysfunction links metabolic and inflammatory markers of aging to death in Drosophila. Proc. Natl Acad. Sci. USA 109, 21528-21533 (2012).

    ADS  CAS  PubMed  PubMed Central  Google Scholar 

  42. Rera, M. et al. Modulation of longevity and tissue homeostasis by the Drosophila PGC-1 homolog. Cell Metab. 14, 623-634 (2011).

    CAS  PubMed  PubMed Central  Google Scholar 

  43. Hughes, M. E., Hogenesch, J. B. & Kornacker, K. JTK_CYCLE: an efficient nonparametric algorithm for detecting rhythmic components in genome-scale data sets. J. Biol. Rhythms 25, 372-380 (2010).

    PubMed  PubMed Central  Google Scholar 

  44. Claesson, M. J. et al. Comparison of two next-generation sequencing technologies for resolving highly complex microbiota composition using tandem variable 16S rRNA gene regions. Nucleic Acids Res. 38, e200 (2010).

    PubMed  PubMed Central  Google Scholar 

  45. Rana, A., Rera, M. & Walker, D. W. Parkin overexpression during aging reduces proteotoxicity, alters mitochondrial dynamics, and extends lifespan. Proc. Natl Acad. Sci. USA 110, 8638-8643 (2013).

    ADS  CAS  PubMed  PubMed Central  Google Scholar 

  46. Schneider, C. A., Rasband, W. S. & Eliceiri, K. W. NIH Image to ImageJ: 25 years of image analysis. Nat. Methods 9, 671-675 (2012).

    CAS  PubMed  PubMed Central  Google Scholar 

  47. Copeland, J. M. et al. Extension of Drosophila life span by RNAi of the mitochondrial respiratory chain. Curr. Biol. 19, 1591-1598 (2009).

    CAS  PubMed  Google Scholar 

Download references

Acknowledgements

We thank all members of the Shirasu-Hiza and Canman laboratories for support, discussions and feedback. We also thank D. W. Walker and J. Giebultowicz for fly lines. Other stocks were obtained from the Bloomington Drosophila Stock Center (NIH P40OD018537). Work was supported by Charles H. Revson Foundation (to M.U.), AFAR Glenn Foundation Postdoctoral Fellowship for Aging Research (to M.U.), Celia Lipton Farris and Victor W. Farris Foundation Graduate Student Fellowship (to S.J.P.), NIH T32GM007088 (to J.G.), NIH R01GM117407 (to J.C.C.), NIH R01GM130764 (to J.C.C.), Joe W. and Dorothy Dorsett Brown Foundation (to W.W.J.), NIH R56AG065986 (to W.W.J.), NIH R35GM127049 (to M.S.-H.) and NIH R01AG045842 (to M.S.-H.).

Author information

Authors and Affiliations

Authors

Contributions

M.U. and M.S.-H. conceived the experiments. Experiments were performed and analysed by M.U. (all), A.M.M. (lifespan experiments), S.J.P. and W.W.J. (feeding analysis), J.G. (western blots and lifespan experiments), S.J.T. (qRT–PCR and lifespan experiments), J.S. (lifespan experiments) and N.K. (biochemical and imaging experiments, and western blots). M.U., J.C.C. and M.S.-H. made intellectual contributions, designed the figures and wrote the manuscript.

Corresponding author

Correspondence to Mimi Shirasu-Hiza.

Ethics declarations

Competing interests

The authors declare no competing interests.

Additional information

Peer review information Nature thanks Tor Erik Rusten and the other, anonymous, reviewer(s) for their contribution to the peer review of this work.

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Extended data figures and tables

Extended Data Fig. 1 Lifespan changes in response to different feeding and fasting regimens.

Light blue boxes on graphs indicate duration of TRF (aqua), IF (medium blue), or iTRF (sky blue) during lifespan. a, Schematic of different feeding regimens utilized in Drosophila lifespan screen. b, 12-hour time-restricted feeding (TRF) from day 10 until death shortened female lifespan (top; ad lib, solid gray, n=292; TRF, dashed gray, n=142) and minimally extended male lifespan (bottom; ad lib, solid, n=241; TRF, dashed, n=314). c, In contrast, TRF from days 10-40 extended female (top; ad lib, solid gray, n=292; TRF, dashed gray, n=150) and male (bottom; ad lib, solid gray, n=241; TRF, dashed gray, n=406) lifespan. d, 24-hour intermittent fasting (IF) from day 10-death shortened both female (top; ad lib, solid gray, n=145; IF, dashed gray, n=149) and male (bottom top; ad lib, solid gray, n=241; IF, dashed gray, n=276) lifespan. e, Intermittent time-restricted feeding (iTRF) from day 10-death did not extend lifespan (ad lib, solid gray, n=142; TRF, dashed gray, n=157). f, iTRF regimen from days 10-40 extended male lifespan (ad lib, solid gray, n=323; TRF, dashed gray, n=382). (See Methods and SI for trials, statistics, and source data; n=number of individual flies; p-values were obtained by log-rank analysis (bf).

Extended Data Fig. 2 Characterization of iTRF windows and effect on feeding and dietary restriction.

Light blue boxes on graphs indicate duration of iTRF during lifespan; solid and dashed lines represent flies on ad lib and iTRF diets, respectively. ae, 10-day periods of iTRF in early to mid-life (days 10-40 of adulthood) can extend lifespan but not later in life (days 40-50): (a) days 10-20 with females (ad lib n=311; iTRF n=319); days 20-30 with (b) females (iTRF n=337) and (c) males (ad lib n=323; iTRF n=366); days 30-40 with (d) females (iTRF n=355) and (e) males (iTRF n=293) all extend lifespan. f, g, iTRF days 40-50 of adulthood did not extend male (iTRF n=302) or female (iTRF n=349) lifespan. h, Relative to flies on ad lib diet (dark gray dots, n=13), flies on iTRF (shown as blue or green dots depending on diet phase, n=14) starve during the fasting phase (n.a., no food available) and eat more during the feeding phase (green dots). i, iTRF extended mean lifespan regardless of dietary protein concentration (n=98-347 for each sample of ad lib or iTRF flies at each protein concentration). j, After partial genetic ablation of insulin producing cells, iTRF still extended lifespan (dashed brown, n=424) relative to ad lib diet (solid brown, n=310), to a similar extent as in genetic controls (ad lib, solid gray, n=161; iTRF, dashed gray, n=180). (See Methods and SI for trials, statistics, and source data; n=number of individual flies; ****=p<0.0001; p-values were obtained by log-rank analysis (a-g, and j) and unpaired two-tailed t-test (h-i). Center values=averages; error bars=SEM.).

Extended Data Fig. 3 iTRF delays aging markers (protein aggregation and intestinal dysfunction) and extends lifespan independent of microbiota.

a, Representative western blot of Triton-insoluble protein accumulation of p62/ref(2)P (each sample=30 flies/condition/timepoint; see also Supplementary Fig. 1). b, Quantification of triton insoluble protein levels showed that iTRF flies (light gray) exhibited reduced accumulation of p62/ref(2)P with age, relative to ad lib flies (dark gray) (average of 4 biological repeats). c, Representative images of 40-day old indirect flight muscle stained for polyubiquitin protein aggregates (green), p62/ref(2)P (magenta), and filamentous actin (F-actin, blue); scale bar=50 µm. d, e, iTRF significantly reduced (d) polyubiquitin aggregates and (e) accumulation of p62 aggregates (ad lib n=10 thoraces, iTRF n=11 thoraces). f, iTRF also reduced age-related intestinal over-proliferation, as marked by phospho-histone H3 staining (p-HH3) (ad lib n=8 guts; iTRF n=9 guts); scale bar=50 µm. g, Light blue boxes on graphs indicate duration of iTRF during lifespan. iTRF (dashed line) delayed age-related intestinal barrier dysfunction relative to ad lib (solid line), as marked by decreased numbers of smurf flies (n=8-12 cohorts of 20-31 flies). hj, Light colored boxes on graphs indicate duration of antibiotic treatment (AB, green) or antibiotic treatment plus iTRF diet (blue/green striped) during lifespan. iTRF flies showed delayed age-related growth in microbiome load with age (n=30 flies/condition/timepoint, 4 biological replicates) (h). iTRF extended lifespan upon microbiome clearance via antibiotics treatment during either (i) total lifespan (ad lib n=227, iTRF n=268) or (j) only days 10-40 of adulthood (ad lib n=144, iTRF n=190). (See Methods and SI for trials, statistics, and source data; n=number of flies unless otherwise indicated; n.s.=p>0.05, *=p<0.05, **=p<0.01, ***=p<0.001, ****=p<0.0001; p-values were obtained by ANOVA followed by Tukey’s post-hoc test (b, g, h), unpaired two-tailed student’s t-test (df), and log-rank analysis (i, j). Center values=averages; error bars=SEM.).

Extended Data Fig. 4 Circadian mutants show a normal lifespan response to dietary protein restriction but do not respond to iTRF.

a, Gene expression of timeless, similar to period and Clock, was enhanced by iTRF during the fasting phase (each n=4 biological replicates of 30 female flies/genotype/condition/timepoint; unmarked=n.s.). b, c, Light blue boxes on graphs indicate duration of iTRF during lifespan. Circadian mutants did not respond to iTRF with extended lifespan relative to controls (ad lib n=187-288; iTRF n=290-311): (b) cycle01 (ad lib n=65, iTRF n=121) and (c) timeless01 (ad lib n=120, iTRF n=152) and period01 (ad lib n=215, iTRF n=184) null mutant females did not respond to iTRF with extended lifespan. d, e, (d) cycle01 and (e) period01 mutant females showed a normal “tent-curve” lifespan response to dietary protein titration (n=61-272 flies/genotype/condition/timepoint). f, period01 mutant females did not starve significantly faster than controls whether they have been on iTRF or ad lib diet (controls: ad lib n=31, iTRF n=35; per: ad lib n=27, iTRF n=42). g, Similar to controls (gray, ad lib n=30; light gray, iTRF, n=29), period01 mutant females (orange, ad lib n=27; light orange, iTRF, n=27) ate more on iTRF relative to on ad lib diet. h, Unlike control iTRF flies (light gray), which had reduced accumulation of p62/ref(2)P with age relative to ad lib flies (dark gray), per mutants had similar levels on ad lib (orange) or iTRF (light orange) diets (each dot=1 sample=30 flies; each bar=average of 4 biological repeats). Actin blot is repeated from Fig. 2h because the same western blot was used to quantify Ubiquitin, p62/ref(2)P, and actin (loading control); see also Supplementary Fig. 1. i, Representative images of indirect flight muscle from 40-day-old flies stained for filamentous actin (F-actin, blue), ubiquitin (green), and p62/ref(2)P (magenta) showed that, unlike genetic controls (ad lib n=10, iTRF n=11 thoraces), period mutants did not have decreased polyubiquitin, or p62/ref(2)P aggregate accumulation in response to iTRF (ad lib n=10, iTRF n=10 thoraces); scale bar=50 µm. (See Methods and SI for trials, statistics, and source data; n=number of flies unless otherwise indicated; n.s.=p>0.05, *=p<0.05, **=p<0.01, ***=p<0.001, ****=p<0.0001; p-values were obtained by ANOVA followed by Tukey’s post-hoc test (a, gi) and log-rank analysis (b, c, f). Center values=averages; error bars=SEM.).

Extended Data Fig. 5 period mutants are defective in autophagy regulation and autophagy induction in response to fasting.

a, b, Similar to circadian genes, iTRF increased the peak amplitude of (a) atg1 and (b) atg8a mRNA expression during the fasting period in wild-type flies (gray) but not period01 mutants (orange) (each dot=1 sample of 30 flies; each bar=average of 4 biological repeats). c, d, period01 mutants (orange) had (c) reduced activation of AMPK and (d) high levels of TORC1 activity as marked by S6K phosphorylation, both in response to fasting during iTRF, compared to controls (gray) (each dot=1 sample of 30 flies; each bar=average of 4 biological repeats); see also Extended Data Fig. 10. e, Representative images of posterior midgut cells during fasting phase of iTRF of 35-day-old flies labeled with LysoTracker™ (magenta), GFP-Atg8a (green), and DAPI to label the DNA (blue), showed that control animals (n=8 guts; each dot represents 2-3 Z-stacks of the posterior midgut of 1 animal) had high levels of LysoTracker™ and GFP-Atg8a puncta compared to period mutants (n=8 guts); scale bar=20 µm; white dashed boxes on images represent inset area presented in Fig. 3g. (See Methods and SI for trials, statistics, and source data; n=number of flies unless otherwise indicated; n.s.=p>0.05, *=p<0.05, **=p<0.01, ***=p<0.001, ****=p<0.0001; p-values were obtained by ANOVA followed by Tukey’s post-hoc test (a-d) and unpaired, two-tailed t-test (e). Center values=averages; error bars=SEM.).

Extended Data Fig. 6 Circadian manipulation of upstream metabolic and autophagy regulators partially determines lifespan response to iTRF.

Light blue boxes on graphs indicate duration of iTRF during lifespan. ad, Relative to controls (gray: ad lib, solid, n=161; iTRF, dashed, n=164), which had an ~20% increase in mean lifespan in response to iTRF, circadian overexpression of: (a) dominant-negative (DN) AMPK (K57A, sage green) shortened the lifespan of animals on ad lib diets (solid, n=184) and caused a 13% increase in mean lifespan in response to iTRF (dashed, n=170); (b) constitutively active (CA) AMPK (T184D, dark green) extended lifespan on ad lib diet (solid, n=156) and caused an 8% increase in mean lifespan in response to iTRF (dashed, n=134); (c) dominant-negative (DN) S6K (KQ, light blue) extended lifespan on ad lib diet (solid, n=292) and caused a 12% increase in mean lifespan in response to iTRF (dashed, n=180); (d) constitutively active CA-S6K (STDETE, medium blue) minimally shortened lifespan on ad lib diets (solid, n=237) and caused an 8% increase in mean lifespan in response to iTRF (dashed, n=282). e, f, RU486 feeding did not influence control (e) or per01 (f) lifespan in flies lacking UAS transgenes (control: ad lib n=136-146, iTRF n=129-142; per01: ad lib n=294-501, iTRF n=238-415). (See Methods and SI for trials, statistics, and source data; n=number of flies; p-values were obtained by log-rank analysis (af)).

Extended Data Fig. 7 Circadian regulation of Atg8a is necessary for iTRF and sufficient to extend lifespan.

a, Using tim-GAL4 to drive expression of mCherry-atg8a, we confirmed oscillating mCherry-Atg8a and free mCherry protein expression by western blot analysis (see also Supplementary Fig. 1), which demonstrated circadian autophagic flux in controls on ad lib diet (each lane=30 flies; each time point of quantification=average of 3 biological repeats). bd, Solid lines represent ad lib flies; dashed lines represent iTRF flies; light blue boxes on graphs indicate duration of iTRF during lifespan. RNAi-mediated circadian knockdown of (b) atg1 (pink: ad lib n=217, iTRF n=166) and (c) atg8a (purple: ad lib n=196, iTRF n=139) was necessary for iTRF-mediated lifespan extension (controls, gray: ad lib n=194-316, iTRF n=196-409. (d) Circadian overexpression of mCherry-Atg8a was sufficient to extend lifespan on ad lib diet (solid lines: gray, control n=185; purple, mCh-atg8a n=422) and responded minimally to iTRF (dashed lines: gray, control n=421, purple, mCh-atg8a n=437). (See Methods and SI for trials, statistics, and source data; n=number of flies unless otherwise indicated; p-values were obtained by log-rank analysis (bd). Center values=averages; error bars=SEM.).

Extended Data Fig. 8 atg1 is necessary and sufficient for iTRF-mediated delays in aging-associated climbing defects and protein aggregation.

a, c, Light blue boxes on graphs indicate duration of iTRF during lifespan. a, b, Relative to controls (gray), circadian knockdown of atg1 (pink) increased aging markers of (a) climbing defects (n=10 vials of 10 flies/condition/genotype/timepoint) and (b) protein aggregation (each lane=30 flies; each time point of quantification=average of 4 biological repeats) and made flies resistant to the effects of iTRF (dashed lines, lighter shades), relative to ad lib diets (solid lines, darker shades). c, d, In contrast, relative to controls (gray), circadian overexpression of atg1 (magenta) decreased aging markers of (c) climbing defects (n=10 vials of 10 flies/condition/genotype/timepoint) and (d) protein aggregation (each lane=30 flies; each time point of quantification=average of 4 biological repeats; see also Supplementary Fig. 1) and also made flies resistant to the effects of iTRF (dashed lines), relative to ad lib diets (solid lines). (See Methods and SI for trials, statistics, and source data; n=number of flies unless otherwise indicated; n.s.=p>0.05, ***=p<0.001, ****=p<0.0001; p-values were obtained by ANOVA followed by Tukey’s post-hoc test (ad). Center values=averages; error bars=SEM.).

Extended Data Fig. 9 Enhanced autophagy specifically during the night phase is necessary and sufficient for TRF-mediated lifespan extension.

a, RU-induced overexpression of atg1 during iTRF-like phases of the circadian cycle causes circadian enhanced, night-specific expression of atg1 (n=4 biological replicates of 30 flies/timepoint/condition; unmarked=n.s.). b, c, Light aqua boxes on graphs indicate duration of shifted-TRF during lifespan. b, Relative to ad lib diet (period01 mutants ad lib, solid orange, n=225), neither night-biased 12:12 treatment of shifted TRF (dashed orange, n=228) or RU-induced atg1 expression (solid magenta, n=319) alone extended the lifespan of per01 mutants. Combined, night-biased 12:12 shifted TRF and RU-induced atg1 expression modestly increased lifespan of per01 mutants (dashed magenta, n=239). c, Replotted here are per01 mutants on ad lib diet (solid orange, n=225) and on night-biased 12:12 shifted TRF (dashed orange, n=228). Day-biased 12:12 RU-induced exogenous atg1 expression decreased the lifespan of per01 mutants (solid magenta, n=206); this lifespan was increased by night-biased shifted TRF (dashed magenta, n=192). Also shown below are re-plots comparing control and per01 mutant backgrounds with night (b) and day (c) biased RU-induced atg1 expression on ad lib diet (second row) or shifted TRF (third row). d, Graphic schematic illustrating endogenous rhythms of atg1 expression (gray) and the predicted effects of RU treatment and 12:12 TRF, either night biased and day-biased, on exogenous atg1 expression. (See Methods and SI for trials, statistics, and source data; n=number of flies unless otherwise indicated; n.s.=p>0.05, ***=p<0.001, ****=p<0.0001; p-values were obtained by ANOVA followed by Tukey’s post-hoc test (a) and log-rank analysis (b, c). Center values=averages; error bars=SEM.).

Supplementary information

41586_2021_3934_MOESM1_ESM.pdf

This file contains the Western blots used in this article Dashed orange boxes indicate region of blot shown in each figure. (a) Blots in Figure 1f and Extended Data Figure 3a showing anti-Ubiquitin (Ub, top), anti-p62 (ref(2)P; center), and anti-Actin (bottom) western blot staining of ad lib or iTRF fed-flies at days 7 or 40 post-eclosion. (b) Blots in Figure 2h and Extended Data Figure 4h showing anti-Ubiquitin (Ub, top), anti-p62 (ref(2)P; center), and anti-Actin (bottom) western blot staining of control and period mutant flies fed ad lib or iTRF diets at days 7 or 40 post-eclosion. (c) Blots in Figure 3e showing anti-mCherry (top) and anti-Actin (bottom) western blot staining of control and period mutant flies. (d) Blots in Extended Data Figure 7a showing anti-mCherry (top) and anti-Actin (bottom) western blot staining of control and timeless-GAL4 driven mCherry-atg8a expressing flies. (e) Blots in Extended Data Figure 8b showing anti-Ubiquitin (Ub, top), anti-p62 (ref(2)P; center), and anti-Actin (bottom) western blot staining of control and atg1-RNAi flies fed ad lib or iTRF diets at days 7 or 40 post-eclosion. (f) Blots in Extended Data Figure 8d showing anti-Ubiquitin (Ub, top), anti-p62 (ref(2)P; center), and anti-Actin (bottom) western blot staining of control and Atg1-overexpressing flies fed ad lib or iTRF diets at days 7 or 40 post-eclosion.

Reporting Summary

Supplementary Table 1

Supplementary Table 1 contains exact n, mean and medians, number of trials, and statistics for all lifespan experiments (Figures 1-4, Extended Data Figures 1-4 and 6-9), as well as climbing assays (Figures 2g, 8a, and 8c). Repeats are listed as “rep” in the “Figure” column; LS = lifespan; n=number of individual flies; p-values were obtained by log-rank analysis.

Supplementary Table 2

Supplementary Table 2 is the raw data source file, composed of a spreadsheet with 13 tabs; each tab contains the source data for a figure (Fig. 1-4) or extended data figure (ED1-9). Source data include tables of subjects at risk for lifespans, average food intake as measured by CaFe assay, percent flies past the marker for climbing assays, calculated mRNA levels using standard qRT-PCR methods, and blot quantitations.

Rights and permissions

Reprints and Permissions

About this article

Verify currency and authenticity via CrossMark

Cite this article

Ulgherait, M., Midoun, A.M., Park, S.J. et al. Circadian autophagy drives iTRF-mediated longevity. Nature 598, 353–358 (2021). https://doi.org/10.1038/s41586-021-03934-0

Download citation

  • Received:

  • Accepted:

  • Published:

  • Issue Date:

  • DOI: https://doi.org/10.1038/s41586-021-03934-0

Further reading

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.

Search

Quick links

Nature Briefing

Sign up for the Nature Briefing newsletter — what matters in science, free to your inbox daily.

Get the most important science stories of the day, free in your inbox. Sign up for Nature Briefing